standard rt pcr conditions (Bio-Rad)
Bio-Rad is a verified supplier 
96
Structured Review
Bio-Rad
standard rt pcr conditions
Standard Rt Pcr Conditions, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 966 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/standard+rt+pcr+conditions/Master+Mix+For+PCR/pmc12014491-223-5-34
Average 96 stars, based on 966 article reviews
Standard Rt Pcr Conditions, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 966 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/standard+rt+pcr+conditions/Master+Mix+For+PCR/pmc12014491-223-5-34
Average 96 stars, based on 966 article reviews
standard rt pcr conditions - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Nucleic Acid Electrophoresis:Article Title: Comparative mutant analyses reveal a novel mechanism of ARF regulation in land plants Article Snippet: Primers for qPCR were designed spanning intron/exon boundaries for auxin-responsive gene ZmSAUR27 (Zm00001eb104110, primers AER639:CTGGAGGGTGGAAAGGGAAG, AER640:AGCATCAAAAGGCTCCATGGA) and the GAPDH housekeeping gene (Zm00001eb173410, primers AER647:CATCATTCCTAGCAGCACCG, AER648:TACACAAGCAGCAACCATCC) using Benchling and checked for specificity using the Maize GDB BLAST tool ( https://www.maizegdb.org/ ). .. Primers were then tested using |